SABIIA - Sistema Aberto e Integrado de Informação em Agricultura (Sabiia)

Teixeira,J.M.S.; Camara,G.N.N.L.; Pimentel,P.F.V.; Ferreira,M.N.R.; Ferreira,M.S.R.; Alfieri,A.A.; Gentsch,J.R.; Leite,J.P.G..

Group C rotaviruses are fastidious in their in vitro cell culture requirements. Recent serosurveys indicate that antibody to group C rotavirus is present in 3-45% of the human population in certain geographic locations, suggesting that rotavirus group C infection is more prevalent than previously believed and that the low rate of detection of these agents is probably due to the lack of sensitive diagnostic assays. From March to December 1994, 406 fecal specimens were collected from children under five years of age who were outpatients at the emergency services of nine public hospitals in Brasília, Federal District, Brazil. In addition to the samples from children, one public outpatient unit requested virological investigation of a stool sample from an...

Detection of mouse hepatitis virus in mouse colonies using the nested polymerase chain reaction

Palavras-chave: Group C rotavirus; Diarrhea; HIV; RT-PCR; Probe hybridization.

Ano: 1998

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X1998001100005

Arq. Bras. Med. Vet. Zootec.

Cecílio,A.B.; Cândido,A.L.; Resende,M.; Bontempo,E.D.; Martins,A.S..

A reverse transcriptase polymerase chain reaction (RT-PCR) to detect mouse hepatitis virus (MHV) in hepatic tissue was developed. To circumvent possible failures in RT-PCR amplifications, a second round of PCR with internal primers was used to confirm the specificity and increase the sensitivity of the test. Using this method specific amplification of MHV sequences was observed in 18 out of 20 mouse colonies examined.

Sequence analysis of the capsid protein gene of an isolate of Apple stem grooving virus, and its survey in Southern Brazil

Palavras-chave: Mouse hepatitis virus; RT-PCR.

Ano: 2000

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0102-09352000000400003

In vitro cytotoxicity of the LDE: daunorubicin complex in acute myelogenous leukemia blast cells

NICKEL,OSMAR; FAJARDO,THOR V.M.; JELKMANN,WILHELM; KUHN,GILMAR B..

Apple stem grooving virus (ASGV) is one of the most important viruses infecting fruit trees. This study aimed at the molecular characterization of ASGV infecting apple (Malus domestica) plants in Santa Catarina (SC). RNA extracted from plants infected with isolate UV01 was used as a template for RT-PCR using specific primers. An amplified DNA fragment of 755 bp was sequenced. The coat protein gene of ASGV isolate UV01 contains 714 nucleotides, coding for a protein of 237 amino acids with a predicted Mr of approximately 27 kDa. The nucleotide and the deduced amino acid sequences of the coat protein gene showed identities of 90.9% and 97.9%, respectively, with a Japanese isolate of ASGV. Very high amino acid homologies (98.7%) were also found with Citrus...

Tipo: Info:eu-repo/semantics/other

Palavras-chave: Molecular characterization; Capillovirus; RT-PCR.

Ano: 2001

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-41582001000300014

Dorlhiac-Llacer,P.E.; Marquezini,M.V.; Toffoletto,O.; Carneiro,R.C.G.; Maranhão,R.C.; Chamone,D.A.F..

Acute myelogenous leukemia (AML) blast cells show high-affinity degradation of low-density lipoprotein (LDL), suggesting an increased expression of cellular LDL receptors. LDE is a lipid microemulsion easily synthesized in vitro which is known to mimic the metabolic pathway of LDL. We used LDE as a carrier for daunorubicin and assayed the cytotoxicity of the complex using AML blast cells since RT-PCR analysis showed that AML cells express LDL receptor mRNA. The LDE:daunorubicin complex killed 46.7% of blast cells and 20.2% of normal bone marrow cells (P<0.001; Student t-test). Moreover, this complex destroyed AML blast cells as efficiently as free daunorubicin. Thus, LDE might be a suitable carrier of chemotherapeutic agents targeting these drugs to...

Acute promyelocytic leukemia: the study of t(15;17) translocation by fluorescent in situ hybridization, reverse transcriptase-polymerase chain reaction and cytogenetic techniques

Palavras-chave: Cytotoxicity; Acute myelogenous leukemia; Daunorubicin; Low-density lipoprotein; LDE complex; RT-PCR.

Ano: 2001

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2001001000004

Chauffaille,M.L.L.F.; Figueiredo,M.S.; Beltrani,R.; Antunes,S.V.; Yamamoto,M.; Kerbauy,J..

Acute promyelocytic leukemia (AML M3) is a well-defined subtype of leukemia with specific and peculiar characteristics. Immediate identification of t(15;17) or the PML/RARA gene rearrangement is fundamental for treatment. The objective of the present study was to compare fluorescent in situ hybridization (FISH), reverse transcriptase-polymerase chain reaction (RT-PCR) and karyotyping in 18 samples (12 at diagnosis and 6 after treatment) from 13 AML M3 patients. Bone marrow samples were submitted to karyotype G-banding, FISH and RT-PCR. At diagnosis, cytogenetics was successful in 10 of 12 samples, 8 with t(15;17) and 2 without. FISH was positive in 11/12 cases (one had no cells for analysis) and positivity varied from 25 to 93% (mean: 56%). RT-PCR was done...

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Palavras-chave: Acute promyelocytic leukemia; Karyotype; FISH; RT-PCR; PML/RARA genem rearrangement.

Ano: 2001

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2001000600006

Rev. bras. sementes

Dantas,Bárbara França; Aragão,Carlos Alberto; Araújo-Junior,João Pessoa; Rodrigues,João Domingos; Cavariani,Cláudio; Nakagawa,João.

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina;...

Detecção de Closterovirus em videira e caracterização parcial de um isolado do Grapevine leafroll-associated virus 3

Palavras-chave: Zea mays; Sementes; Alfa-amilase; RT-PCR.

Ano: 2002

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0101-31222002000200019

FAJARDO,THOR V.M.; KUHN,GILMAR B.; EIRAS,MARCELO; NICKEL,OSMAR.

O enrolamento da folha da videira (Vitis spp.) é uma doença causada por até oito vírus, Grapevine leafroll-associated virus (GLRaV) 1 a 8, sorologicamente distintos e associados ao floema de videiras infetadas. Neste trabalho, foram detectados GLRaV-1 e -3 por DAS-ELISA em 6,9 e 14,7% das amostras analisadas, respectivamente, e provenientes de duas importantes regiões vitícolas do Brasil (Serra Gaúcha e Vale do São Francisco). Os GLRaV-2, -5 e -7 não foram detectados. O GLRaV-3 também foi detectado por dot-ELISA e western blot, observando-se a provável proteína capsidial com cerca de 36 kDa. Um fragmento de 340 pb, compreendendo o terminal 3' do gene da polimerase viral de GLRaV-3, foi amplificado por PCR e seqüenciado. As seqüências de nucleotídeos e...

Sm14 gene expression in different stages of the Schistosoma mansoni life cycle and immunolocalization of the Sm14 protein within the adult worm

Palavras-chave: Vitis; GLRaV-1; GLRaV-3; Sorologia; RT-PCR; RNA polimerase.

Ano: 2002

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-41582002000100009

Kinetics of TNF-alpha and IFN-gamma mRNA expression in islets and spleen of NOD mice

Brito,C.F.A.; Oliveira,G.C.; Oliveira,S.C.; Street,M.; Riengrojpitak,S.; Wilson,R.A.; Simpson,A.J.G.; Correa-Oliveira,R..

Sm14 is a 14-kDa vaccine candidate antigen from Schistosoma mansoni that seems to be involved in cytoplasmic trafficking of fatty acids. Although schistosomes have a high requirement for lipids, they are not able to synthesize fatty acids and sterols de novo. Thus, they must acquire host lipids. In order to determine whether Sm14 is present in different stages of the life cycle of the parasite, we performed RT-PCR. Sm14 mRNA was identified in all stages of the life cycle studied, mainly schistosomulum, adult worm and egg. Additionally, we used a rabbit anti-Sm14 polyclonal antibody in an indirect immunofluorescence assay to localize Sm14 in adult worm sections. The basal lamella of the tegument and the gut epithelium were strongly labeled. These tissues...

Tipo: Info:eu-repo/semantics/other

Palavras-chave: Sm14; Fatty acid-binding protein; FABP; Immunolocalization; RT-PCR.

Ano: 2002

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2002000300014

Ventura-Oliveira,D.; Vilella,C.A.; Zanin,M.E.; Castro,G.M.; Moreira Filho,D.C.; Zollner,R.L..

Insulin-dependent diabetes mellitus is caused by autoimmune destruction of pancreatic ß cells. Non-obese diabetic (NOD) mice spontaneously develop diabetes similar to the human disease. Cytokines produced by islet-infiltrating mononuclear cells may be directly cytotoxic and can be involved in islet destruction coordinated by CD4+ and CD8+ cells. We utilized a semiquantitative RT-PCR assay to analyze in vitro the mRNA expression of TNF-alpha and IFN-gamma cytokine genes in isolated islets (N = 100) and spleen cells (5 x 10(5) cells) from female NOD mice during the development of diabetes and from female CBA-j mice as a related control strain that does not develop diabetes. Cytokine mRNAs were measured at 2, 4, 8, 14 and 28 weeks of age from the onset of...

Development of a quantitative competitive reverse transcriptase polymerase chain reaction for the quantification of growth hormone gene expression in pigs

Palavras-chave: Diabetes; NOD mice; Cytokines; RT-PCR; Pancreatic islets; Time course.

Ano: 2002

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2002001100013

Genet. Mol. Biol.

Franco,Maurício Machaim; Almeida,Juliana Franco; Souza,Guilherme Rocha Lino de; Antunes,Robson Carlos; Goulart,Luiz Ricardo.

After the advent of the genome projects, followed by the discovery of DNA polymorphisms, basic understanding of gene expression is the next focus to explain the association between polymorphisms and the level of gene expression, as well as to demonstrate the interaction among genes. Among the various techniques for the investigation of transcriptional profiling involving patterns of gene expression, quantitative PCR is the simplest analytical laboratory technique. The objective of this work was to analyze two strategies of a competitive PCR technique for the quantification of the pig growth hormone (GH) gene expression. A pair of primers was designed targeting exons 3 and 5, and two competitive PCR strategies were performed, one utilizing a specific...

TRANSCRIPTOS DE FUSIÓN DEL GEN BCR/ABL EN PACIENTES CON LEUCEMIA MIELOIDE CRÓNICA

Palavras-chave: Pig; GH gene; Gene expression; RT-PCR.

Ano: 2003

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1415-47572003000100003

International Journal of Morphology

Artigas,Carmen Gloria; Melo,Angélica; Roa,Juan Carlos; Roa,Iván; Quijada,Ingrid; Vittini,Cecilia; Cabrera,María Elena; Risueño,Concepción.

La anormalidad citogenética más común en la leucemia mieloide crónica (LMC) es el cromosoma Philadelphia, producida por la t(9;22), cuya expresión molecular es el gen de fusión BCR-ABL, que codifica proteínas con actividad tirosinquinasa. Según el punto de ruptura de los genes BCR o ABL se produce una proteína de fusión de 210-kD(p210) o 190-kD(p190). La presencia de este gen de fusión en pacientes con LMC tiene implicancia diagnóstica. Con el propósito de detectar transcriptos de fusión del gen BCR/ABL en pacientes con leucemia mieloide crónica, procedentes de la IX Región de Chile, se estudiaron 14 muestras de sangre de 11 pacientes con LMC. A 2 de ellos, se les realizó seguimiento durante su tratamiento con Gleevec. Se aplicó la técnica de reacción en...

Tipo: Journal article

Palavras-chave: BCR/ABL; RT-PCR; Leucemia mieloide crónica; Chile.

Ano: 2003

URL: http://www.scielo.cl/scielo.php?script=sci_arttext&pid=S0717-95022003000300004

An isolate of Apple stem grooving virus associated with Cleopatra mandarin fruit intumescence

Lovisolo,Osvaldo; Accotto,Gian Paolo; Masenga,Vera; Colariccio,Addolorata.

A citrus tatter leaf isolate (CTLV-Cl) of Apple stem grooving virus (ASGV) has been found to be associated with a fruit rind intumescence in Cleopatra mandarin (Citrus reshni) in Limeira (SP). The CTLV-Cl was mechanically transmitted to the main experimental herbaceous hosts of CTLV. Chenopodium quinoa and C. amaranticolor reacted with local lesions and systemic symptoms while other test plants reacted somewhat differently than what is reported for CTLV. A pair of primers designed for specific detection of ASGV and CTLV amplified the expected 801 bp fragment from the CTLV-Cl-infected plants. Typical capillovirus-like particles were observed by the electron microscope in experimentally infected C. quinoa and C. amaranticolor leaves.

Comparison of four extraction methods to detect hepatitis A virus RNA in serum and stool samples

Palavras-chave: Citrus tatter leaf virus; Capillovirus; RT-PCR.

Ano: 2003

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-41582003000100008

BJID

Paula,Vanessa Salete de; Villar,Livia Melo; Gaspar,Ana Maria Coimbra.

The efficiency of extraction methods for hepatitis A virus (HAV) RNA in clinical samples is of great importance for molecular diagnosis, especially in regions endemic for HAV, such as Brazil. We compared the efficiency of four different extraction techniques in serum and stool samples for the detection of hepatitis A virus by reverse transcription PCR (RT-PCR). We used PCR to analyse serum and stool samples of 12 patients who were referred to the Brazilian Reference Center for Viral Hepatitis (BRCVH) in Rio de Janeiro. The methods tested were Proteinase K, Silica, TRIzol and Guanidine isothiocyanate. Proteinase K extraction was the best method for serum samples; it detected the HAV-RNA in 11 of the 12 samples. The guanidine isothiocyanate method was the...

Les Toxi-Infections Alimentaires Collectives (TIAC) virales associées à la consommation d'huîtres en France, hiver 2000-2001

Palavras-chave: HAV; Extraction methods; Serum and stool; RT-PCR.

Ano: 2003

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1413-86702003000200007

ArchiMer

Zidane, Mohamed; Le Guyader, Soizick; Pommepuy, Monique.

During the winter 2000/2001, several outbreaks associated with the consumption of shellfish were declared in France. Following these events, a close cooperation was organized between administrations and laboratories (DGAL, DPMA, InVS, AFSSA, Ifremer, CHU-Dijon and CNC) to gather competences and to manage the situation. This report synthesizes the information collected during these outbreaks. From the outset, the epidemiologic investigations directed the research towards viral contamination and shellfish as contamination source. Several outbreaks were investigated. Oysters and stools samples from ill patients were analysed by RT-PCR for viruses (enterovirus, rotavirus, norovirus and astrovirus). The genic amplification was done by using the same primers in...

Tipo: Text

Palavras-chave: Épidémie; Gastro-entérites; Huîtres; Contamination virale; RT-PCR; Norovirus; TIAC.

Ano: 2004

URL: http://archimer.ifremer.fr/doc/00068/17941/15476.pdf

Detection of three Allexivirus species infecting garlic in Brazil

PAB

Melo Filho,Péricles de Albuquerque; Nagata,Tatsuya; Dusi,André Nepomuceno; Buso,José Amauri; Torres,Antonio Carlos; Eiras,Marcelo; Resende,Renato de Oliveira.

Garlic viruses often occur in mixed infections under field conditions. In this study, garlic samples collected in three geographical areas of Brazil were tested by Dot-ELISA for the detection of allexiviruses using monoclonal specific antibodies to detect Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C) and a polyclonal antiserum able to detect the three virus species mentioned plus Garlic virus D (GarV-D). The detected viruses were biologically isolated by successive passages through Chenopodium quinoa. Reverse Transcriptase Polimerase Chain Reaction (RT-PCR) was performed using primers designed from specific regions of the coat protein genes of Japanese allexiviruses available in the Genetic Bank of National Center of...

Tomato chlorotic spot virus in hydroponically-grown lettuce in São Paulo State, Brazil

Palavras-chave: Allium sativum; Virus detection; Coat protein; Dot-ELISA; RT-PCR.

Ano: 2004

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2004000800002

Colariccio,Addolorata; Eiras,Marcelo; Chaves,Alexandre L. R.; Harakava,Ricardo; Chagas,César M..

In the regions of Campinas and Sumaré, São Paulo, Brazil, hidroponically grown crops of Lettuce (Lactuca sativa) cv. Verônica, which showed virus-like symptoms were examined by electron microscope, biological, serological and molecular tests. Pleomorphic, enveloped particles (80-100 nm in diameter) were always detected in these samples. Experimentally inoculated host plants, including lettuce, reacted with tospoviruses-induced symptoms. Some differences were observed in Gomphrena globosa, which reacted by showing local lesions and systemic mosaic. Two isolates of Tomato chlorotic spot virus (TCSV) were identified by DAS-ELISA and by RT-PCR. The sequencing and alignment of the RT-PCR coat protein amplified fragments have indicated a high degree of homology...

Tipo: Info:eu-repo/semantics/other

Palavras-chave: Tospovirus; Serology; RT-PCR; Sequencing.

Ano: 2004

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-41582004000300012

Lesões histológicas no sistema nervoso central de cães com encefalite e diagnóstico molecular da infecção pelo vírus da cinomose canina

Arq. Bras. Med. Vet. Zootec.

Gebara,C.M.S.; Wosiacki,S.R.; Negrão,F.J.; Alfieri,A.A.; Alfieri,A.F..

Dez amostras de urina de cães que apresentavam sinais clínicos sistêmicos e neurológicos indicativos da infecção pelo vírus da cinomose canina (CDV) foram analisadas pela técnica da reação em cadeia pela polimerase precedida de transcrição reversa (RT-PCR) para a detecção do RNA do CDV. O exame histopatológico foi realizado em fragmentos de cérebro, cerebelo e bexiga. Como controle negativo foram colhidos fragmentos de órgãos e urina de quatro cães sem sinais clínicos de doença infecciosa e que morreram por outras causas. Todos os cães (9/10) positivos em RT-PCR apresentaram alterações histológicas no cérebro e cerebelo, características de encefalite aguda (5/9) ou crônica (4/9) compatíveis com as causadas pelo CDV. Um dos cães com alterações clínicas...

Tipo: Info:eu-repo/semantics/report

Palavras-chave: Cão; Cinomose canina; Vírus da cinomose canina; RT-PCR; Histopatologia.

Ano: 2004

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0102-09352004000200005

Detecção do gene da nucleoproteína do vírus da cinomose canina por RT-PCR em urina de cães com sinais clínicos de cinomose

Arq. Bras. Med. Vet. Zootec.

Gebara,C.M.S.; Wosiacki,S.R.; Negrão,F.J.; Oliveira,D.B de; Beloni,S.N.E.; Alfieri,A.A.; Alfieri,A.F..

A presença do vírus da cinomose canina (CDV) foi avaliada pela reação em cadeia da polimerase, precedida de transcrição reversa (RT-PCR), em 87 amostras de urina de cães que apresentavam sinais clínicos sugestivos de cinomose. Os animais foram distribuídos em três grupos. No grupo A foram incluídos 41 cães com alterações sistêmicas; no grupo B, 37 cães com alterações neurológicas; e no grupo C, nove cães com alterações sistêmicas e neurológicas simultâneas. O grupo D (controle) foi composto por 20 cães assintomáticos. Os resultados da RT-PCR foram correlacionados com a forma clínica da infecção e com as alterações hematológicas encontradas. Foi possível a amplificação parcial do gene da nucleoproteína do CDV em 41 (47,1%) das 87 amostras de urina...

CaV 3.1 and CaV 3.3 account for T-type Ca2+ current in GH3 cells

Palavras-chave: Cinomose canina; Vírus da cinomose; Urina; RT-PCR.

Ano: 2004

URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0102-09352004000400009

Mudado,M.A.; Rodrigues,A.L.; Prado,V.F.; Beirão,P.S.L.; Cruz,J.S..

T-type Ca2+ channels are important for cell signaling by a variety of cells. We report here the electrophysiological and molecular characteristics of the whole-cell Ca2+ current in GH3 clonal pituitary cells. The current inactivation at 0 mV was described by a single exponential function with a time constant of 18.32 ± 1.87 ms (N = 16). The I-V relationship measured with Ca2+ as a charge carrier was shifted to the left when we applied a conditioning pre-pulse of up to -120 mV, indicating that a low voltage-activated current may be present in GH3 cells. Transient currents were first activated at -50 mV and peaked around -20 mV. The half-maximal voltage activation and the slope factors for the two conditions are -35.02 ± 2.4 and 6.7 ± 0.3 mV (pre-pulse of...